CRISPER AND HEALTHSPAN

“If you could only read one book this year, 

this should be the one.” -tnm

If you haven’t already read the early signs,  the newest chapter on Human Evolution is being written and it all starts with a lesson learned from bacteria.  You see,  bacteria “learned” how to block viral attacks and have been fending off viruses (known as phages or bacteriophages) for about three billion years. 

So bacteria, it turns out “remember” viral attacks by snipping a segment of phage DNA which gives these bacteria an acquired immunity against that specific virus.  It’s a bacterial way of taking a “DNA mug shot” of an attacking virus for future use for 3 billion years!

It took a very long time for humans to notice but it was Francisco Mojica (the University of Alicante, Spain) who discovered the first clue about how this was done.  Mojica spotted 14 identical DNA sequence clusters repeated at regular intervals in a single celled species he was studying.  He wanted to know more about this organism (without a nucleus) that enables it to survive in water 12 times saltier than the ocean. Its DNA sequences were palindromic, they read both ways like the words madam, kayak, rotor, civic and radar. Here’s the bottom line, Mojica discovered in it’s DNA...  Clustered Regularly Interspaced Short Palendromic Repeats ... In 2001 he coined the term: CRISPR.

But what’s this have to do with the future of human evolution?  This is where Jennifer Doudna and Emmanuelle Charpentier step into the story along with the ghost of Rosalind Franklin.

This is one of those uncommon books that is on my Must Read List of Recommendations.  

It introduces CRISPER as the newest tool in our collection:  HEALTH-SPAN ENCYCLOPAEDIA. I’m reading the last chapters now and can’t wait to share with you the interesting and species changing events that are beginning to unfold as I pen these words.  CRISPER is a relatively easy to use tool that can be used to edit DNA.

C cytosine, U uracil, G guanine, A adenine (found in RNA)
C cytosine, U uracil, G guanine, A adenine, and T thymine (found in DNA)

A snippet of corona virus RNA 

CCUCGGCGGGCACGUAGUGUAGCUAGUCAAUCCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAUUC.  

This is part of a string that codes for making the protein spikes that inspires the name corona virus. Click HERE for an image. The first 12 base letters (in bold) is the part of the viral RNA sequence that binds this virus to human cells. These 12 letters spell our current pandemic. Were there to be a typographic error in this sequence, there would be no COVID-19.

Steve Wozniak and his Homebrew Computer Club hacker friends in the early days before personal computers triggered an unparalleled technological revolution, that pales by comparison to what’s coming next, The Biological Revolution.  

Internet startups sang the praises of their mantra: “Move fast and break things.” Which has heaped a raft of unintended consequences and vexing problems, a toxic wasteland, that could have been avoided had many of the early tech industry leaders followed a more mindful philosophy. But too many IT CEO’s were seduced by unimaginable profits, often at the expense of the human race. Ethical considerations were trumped by profit taking on a grand scale.

The good news is that the new biological revolution is being guided by a different mantra, this time there is full attention given to ethical questions which illuminates the discussion. The leaders of this new revolution come with a moral compass like Jennifer Doudna, and Emmanuelle Charpentier who are guiding the way forward. I’m thankful we’re in good hands.

Read:

The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race      By Walter Isaacson

Isaacson’s everyday readable rendering of extremely technical science is an enormous accomplishment. Complex science made completely understandable! 

Let’s put Code Breaker on our HEALTH-SPAN BOOK CLUB READING LIST.  Become part of the CRISPER Human Genome dialog.

HERE’S THE BOOK BLURB

The bestselling author of Leonardo da Vinci and Steve Jobs returns with a “compelling” (The Washington Post) account of how Nobel Prize winner Jennifer Doudna and her colleagues launched a revolution that will allow us to cure diseases, fend off viruses, and have healthier babies.

When Jennifer Doudna was in sixth grade, she came home one day to find that her dad had left a paperback titled The Double Helix on her bed. She put it aside, thinking it was one of those detective tales she loved. When she read it on a rainy Saturday, she discovered she was right, in a way. As she sped through the pages, she became enthralled by the intense drama behind the competition to discover the code of life. Even though her high school counselor told her girls didn’t become scientists, she decided she would.

Driven by a passion to understand how nature works and to turn discoveries into inventions, she would help to make what the book’s author, James Watson, told her was the most important biological advance since his codiscovery of the structure of DNA. She and her collaborators turned a curiosity of nature into an invention that will transform the human race: an easy-to-use tool that can edit DNA. Known as CRISPR, it opened a brave new world of medical miracles and moral questions.

The development of CRISPR and the race to create vaccines for coronavirus will hasten our transition to the next great innovation revolution. The past half-century has been a digital age, based on the microchip, computer, and internet. Now we are entering a life-science revolution. Children who study digital coding will be joined by those who study genetic code.

Should we use our new evolution-hacking powers to make us less susceptible to viruses? What a wonderful boon that would be! And what about preventing depression? Hmmm…Should we allow parents, if they can afford it, to enhance the height or muscles or IQ of their kids?

After helping to discover CRISPR, Doudna became a leader in wrestling with these moral issues and, with her collaborator Emmanuelle Charpentier, won the Nobel Prize in 2020. Her story is an “enthralling detective story” (Oprah Daily) that involves the most profound wonders of nature, from the origins of life to the future of our species.

 

Click HERE for another excellent explanation by Ananya Sen

a kind of bacterial/viral version of Capture The Flag.

DISCUSSION COMING SOON.