Optimal living for 120 years and beyond is now within reach. While the exact number of years may be uncertain, the outcome is clear, more than ever we can position ourselves for getting the most out of a longer life. Follow this blog to see how it can be done! This is not so much about longevity, it's about a longer HEALTHSPAN: healthy, meaningful, vigorous living!
Tai Chi teaches Mindfulness, and a not-so-obvious effortless effort ...
not visible when you just watch Tai Chi.
This is an excellent video for first timers to practice Tai Chi. Bring this up on your flat screen and follow along.
#1 Simplified 24 Tai Chi Routine.
My next goal, Chen Style 73 Competition double jump
Double Jump isolation
Monday, November 1, 2021
Our lymphatic system removes impurities and waste products from the fluids that surround our cells, protecting us from toxins and maintaining our immune system other anatomical systems at their best. I just learned that when the lymphatic system is blocked from doing its job, maladies like alzheimer’s have nothing to hold them back.
1. Because the podcast overflows with too many anatomy and physiology terms, it will help to first watch this introductory video from the National Institute of Neruological Disorders and Stroke.
Dr. Daniel Reich from NINDS discusses how our brains may drain waste through lymphatic vessels, the body’s under studied clean up system.
2. Now click HERE for the Podcast: The Key to Optimal Health
The first segment (4 minutes) is largely advertising. As time is precious you can “fast forward” using the time bar at the bottom of the podcast by moving the scrubber to 4:00.
This podcast comes recommended by: _____ ______ (waiting for permission).
If you haven’t already read the early signs, the newest chapter on Human Evolution is being written and it all starts with a lesson learned from bacteria. You see, bacteria “learned” how to block viral attacks and have been fending off viruses (known as phages or bacteriophages) for about three billion years.
So bacteria, it turns out “remember” viral attacks by snipping a segment of phage DNA which gives these bacteria an acquired immunity against that specific virus. It’s a bacterial way of taking a “DNA mug shot” of an attacking virus for future use for 3 billion years!
It took a very long time for humans to notice but it was Francisco Mojica (the University of Alicante, Spain) who discovered the first clue about how this was done. Mojica spotted 14 identical DNA sequence clusters repeated at regular intervals in a single celled species he was studying. He wanted to know more about this organism (without a nucleus) that enables it to survive in water 12 times saltier than the ocean. Its DNA sequences were palindromic, they read both ways like the words madam, kayak, rotor, civic and radar. Here’s the bottom line, Mojica discovered in it’s DNA... Clustered Regularly Interspaced Short Palendromic Repeats ... In 2001 he coined the term: CRISPR.
It introduces CRISPER as the newest tool in our collection: HEALTH-SPAN ENCYCLOPAEDIA. I’m reading the last chapters now and can’t wait to share with you the interesting and species changing events that are beginning to unfold as I pen these words. CRISPER is a relatively easy to use tool that can be used to edit DNA.
CCUCGGCGGGCACGUAGUGUAGCUAGUCAAUCCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAUUC.
This is part of a string that codes for making the protein spikes that inspires the name corona virus. Click HERE for an image. The first 12 base letters (in bold) is the part of the viral RNA sequence that binds this virus to human cells. These 12 letters spell our current pandemic. Were there to be a typographic error in this sequence, there would be no COVID-19.
Steve Wozniak and his Homebrew Computer Club hacker friends in the early days before personal computers triggered an unparalleled technological revolution, that pales by comparison to what’s coming next, The Biological Revolution.
Internet startups sang the praises of their mantra: “Move fast and break things.” Which has heaped a raft of unintended consequences and vexing problems, a toxic wasteland, that could have been avoided had many of the early tech industry leaders followed a more mindful philosophy. But too many IT CEO’s were seduced by unimaginable profits, often at the expense of the human race. Ethical considerations were trumped by profit taking on a grand scale.
The good news is that the new biological revolution is being guided by a different mantra, this time there is full attention given to ethical questions which illuminates the discussion. The leaders of this new revolution come with a moral compass like Jennifer Doudna, and Emmanuelle Charpentier who are guiding the way forward. I’m thankful we’re in good hands.
Read:
The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race By Walter Isaacson
“In one study, researchers had nearly 400 Chinese men and women with some cognitive impairment perform either tai chi or a stretching and toning program three times a week. After a year, the tai chi group showed greater improvements, and only 2% of that group progressed to dementia, while 11% from the traditional exercise group did.”
A globular, cascading icicle-forming mushroom when cooked tastes like lobster or shrimp. Lion’s mane mushroom researcher Kara-Jiishi discovered in 1993 in Japan that this mushroom stimulates nerves to regrow.
Health span. Increasing the span of healthy/active living.
Step #1
An excellent way to keep your brain healthy for 120 And Beyond is daily exercise and the Mind Diet as described HERE by the Mayo Clinic. The human brain makes up 2% of body's weight but consumes 20% of the body's oxygen supply. Our brains high oxygen demand is so important that it employs drastic measures like fainting to restore circulation and proper oxygen delivery to the brain.
My cardiologist has ordered me to 5-6 days of cardio per week [includes walking]. Cardio vascular activity, like walking or cycling stimulates the heart to increase blood flow and 20% of that increased oxygen supply is gobbled up by your brain! I'm up to about 5 days of cardio per week.
My wearable device tracks my daily steps then sends them to the Activity App on my phone. This works for androids too. From there, I enter the daily total on the custom spreadsheet below. This spreadsheet tallies my steps by the week month and year. I've been tracking my steps since September 17, 2015.
HealthSpan: 120 and Beyond
a life well lived, a life worth living.
Extending health span is the journey, negligible senescence and enjoying life along the way is the quest. So make a list of all the things you want to do. Click HERE.
Enjoyable living beyond 120 is afloat on a rising tide of research bent on repairing the damage that builds up in our bodies during our life time. This enjoyable journey is made possible by pharmacological longevity research, by examining the roots of aging in our DNA, by reducing frailty and disability, by minimizing age-related disease risks and by combining this building body of knowledge with the proactive practice of taking care of what we have along the way.
In September 2013 Google announced the creation of Calico, short for the California Life Company. Its mission is to reverse engineer the biology that controls lifespan and “devise interventions that enable people to lead longer and healthier lives”.
Here are links to 5 research institutes paving the way.
1. Google Calico
2 The Ellison Medical Foundation,
3. The Paul F Glenn Foundation for Medical Research
4. The Buck Institute for Research on Ageing
At the cellular level, the molecular phenotypes of aging are being characterized.
What if neuro precursor cells could be injected directly into the human brain? Would these cells now do what they did in our earliest embryonic development? Would they migrate to their proper place in the brain? Would these new cells effectively replace older, less efficient brain cells that contribute to neurodegeneration? Could this be the breakthrough enabling people to continue to get smarter as we get older?
Have a relative who has lived beyond 90 or 100? How inheritable is longevity? Calico researcher Graham Ruby answers this question. 7% Click HERE for details. He concluded that heritability of lifespan appears to be much lower than previously reported -- as low as seven percent.
