An Invitation to my 120th Birthday Celebration.

After 39 years of teaching, my last words to my students on that final day came in the form of an invitation: "You're all invited to my 120th Birthday. Celebrate it by skiing with me." I think it was Sara who shot up her hand saying: "Wait, wait." (pausing for a quick calculation) "I'll be 77 years old!"
"Don't worry." says I, "I'll slow down for you!"

"Never limit yourself." had been an underlying lesson for my students. I realized that I'd need to engineer a comprehensive plan for myself to optimize the quality of my life to 120 and Beyond.

In order to take good care of your brain for the long game, begin by taking mindful care of your body. Read on to chart your own course for 120 and Beyond.


Tuesday, November 16, 2021

Practice Tai Chi at Home

Tai Chi teaches Mindfulness, and a not-so-obvious effortless effort ... 
not visible when you just watch Tai Chi.  

This is an excellent video for first timers to practice Tai Chi. Bring this up on your flat screen and follow along.  

#1 Simplified 24 Tai Chi Routine.



#2 Narrated Tai Chi Routine coming soon.
 
Each position has a name that will help you learn the routine.




My next goal, Chen Style 73 Competition double jump



Double Jump isolation



Monday, November 1, 2021

The Importance of the Lymphatic System for Longevity and a Longer Health Span:

Monday, November 1, 2021

Following Tai Chi exercise on the beach this morning our group gathered for coffee and conversation. When you examine Blue Zones around the world, places where it’s common for people to live actively beyond 100, a common characteristic they share is an unusually high level of community interaction. So our Tai Chi coffee and conversation group is building our very own personal Blue Zone (click HERE for more).

Our Tai Chi chat jumped across an encyclopedia of topics from the evolution of kanji and learning new languages to a podcast by Dr. Lemole and Dr. Oz. I took a special interest in this podcast about the lymphatic system because it informs our effort to increase health-span.

Our lymphatic system removes impurities and waste products from the fluids that surround our cells, protecting us from toxins and maintaining our immune system other anatomical systems at their best. I just learned that when the lymphatic system is blocked from doing its job, maladies like alzheimer’s have nothing to hold them back.
 

November 3, just finished the informative podcast which is so interesting, we can add it to our “book club” list of topics. Take notes, and we’ll gather back together for a discussion of
THE HEALTH-SPAN ENCYCLOPAEDIA.  


1. Because the podcast overflows with too many anatomy and physiology terms, it will help to first watch this introductory video from the National Institute of Neruological Disorders and Stroke.


Dr. Daniel Reich from NINDS discusses how our brains may drain waste through lymphatic vessels, the body’s under studied clean up system.



2. Now click HERE for the Podcast: The Key to Optimal Health

By: Dr. Oz and Dr. Lemole

 The first segment (4 minutes) is largely advertising. As time is precious you can “fast forward” using the time bar at the bottom of the podcast by moving the scrubber to 4:00. 

This podcast comes recommended by:  _____ ______ (waiting for permission).


This is an introduction to the importance of the lymphatic system. We will dive deeper into this ocean of lymph to learn how it will contribute to our healthspan, what I used to call longevity.

The brain depends on the lymphatic system to remove toxins, and other molecules that contribute, for example, to Alzheimer amyloid plaques.



CRISPER AND HEALTHSPAN

“If you could only read one book this year, 
this should be the one.” -tnm

If you haven’t already read the early signs,  the newest chapter on Human Evolution is being written and it all starts with a lesson learned from bacteria.  You see,  bacteria “learned” how to block viral attacks and have been fending off viruses (known as phages or bacteriophages) for about three billion years. 

So bacteria, it turns out “remember” viral attacks by snipping a segment of phage DNA which gives these bacteria an acquired immunity against that specific virus.  It’s a bacterial way of taking a “DNA mug shot” of an attacking virus for future use for 3 billion years!

It took a very long time for humans to notice but it was Francisco Mojica (the University of Alicante, Spain) who discovered the first clue about how this was done.  Mojica spotted 14 identical DNA sequence clusters repeated at regular intervals in a single celled species he was studying.  He wanted to know more about this organism (without a nucleus) that enables it to survive in water 12 times saltier than the ocean. Its DNA sequences were palindromic, they read both ways like the words madam, kayak, rotor, civic and radar. Here’s the bottom line, Mojica discovered in it’s DNA...  Clustered Regularly Interspaced Short Palendromic Repeats ... In 2001 he coined the term: CRISPR.

But what’s this have to do with the future of human evolution?  This is where Jennifer Doudna and Emmanuelle Charpentier step into the story along with the ghost of Rosalind Franklin.

This is one of those uncommon books that is on my Must Read List of Recommendations.  

It introduces CRISPER as the newest tool in our collection:  HEALTH-SPAN ENCYCLOPAEDIA. I’m reading the last chapters now and can’t wait to share with you the interesting and species changing events that are beginning to unfold as I pen these words.  CRISPER is a relatively easy to use tool that can be used to edit DNA.



C cytosine, U uracil, G guanine, A adenine (found in RNA)
C cytosine, U uracil, G guanine, A adenine, and T thymine (found in DNA)


A snippet of corona virus RNA 

CCUCGGCGGGCACGUAGUGUAGCUAGUCAAUCCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAUUC.  

This is part of a string that codes for making the protein spikes that inspires the name corona virus. Click HERE for an image. The first 12 base letters (in bold) is the part of the viral RNA sequence that binds this virus to human cells. These 12 letters spell our current pandemic. Were there to be a typographic error in this sequence, there would be no COVID-19.




Steve Wozniak and his Homebrew Computer Club hacker friends in the early days before personal computers triggered an unparalleled technological revolution, that pales by comparison to what’s coming next, The Biological Revolution.  

Internet startups sang the praises of their mantra: “Move fast and break things.” Which has heaped a raft of unintended consequences and vexing problems, a toxic wasteland, that could have been avoided had many of the early tech industry leaders followed a more mindful philosophy. But too many IT CEO’s were seduced by unimaginable profits, often at the expense of the human race. Ethical considerations were trumped by profit taking on a grand scale.

The good news is that the new biological revolution is being guided by a different mantra, this time there is full attention given to ethical questions which illuminates the discussion. The leaders of this new revolution come with a moral compass like Jennifer Doudna, and Emmanuelle Charpentier who are guiding the way forward. I’m thankful we’re in good hands.

Read:

The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race      By Walter Isaacson


Isaacson’s everyday readable rendering of extremely technical science is an enormous accomplishment. Complex science made completely understandable! 

Let’s put Code Breaker on our HEALTH-SPAN BOOK CLUB READING LIST.  Become part of the CRISPER Human Genome dialog.


HERE’S THE BOOK BLURB
The bestselling author of Leonardo da Vinci and Steve Jobs returns with a “compelling” (The Washington Post) account of how Nobel Prize winner Jennifer Doudna and her colleagues launched a revolution that will allow us to cure diseases, fend off viruses, and have healthier babies.

When Jennifer Doudna was in sixth grade, she came home one day to find that her dad had left a paperback titled The Double Helix on her bed. She put it aside, thinking it was one of those detective tales she loved. When she read it on a rainy Saturday, she discovered she was right, in a way. As she sped through the pages, she became enthralled by the intense drama behind the competition to discover the code of life. Even though her high school counselor told her girls didn’t become scientists, she decided she would.

Driven by a passion to understand how nature works and to turn discoveries into inventions, she would help to make what the book’s author, James Watson, told her was the most important biological advance since his codiscovery of the structure of DNA. She and her collaborators turned a curiosity of nature into an invention that will transform the human race: an easy-to-use tool that can edit DNA. Known as CRISPR, it opened a brave new world of medical miracles and moral questions.

The development of CRISPR and the race to create vaccines for coronavirus will hasten our transition to the next great innovation revolution. The past half-century has been a digital age, based on the microchip, computer, and internet. Now we are entering a life-science revolution. Children who study digital coding will be joined by those who study genetic code.

Should we use our new evolution-hacking powers to make us less susceptible to viruses? What a wonderful boon that would be! And what about preventing depression? Hmmm…Should we allow parents, if they can afford it, to enhance the height or muscles or IQ of their kids?

After helping to discover CRISPR, Doudna became a leader in wrestling with these moral issues and, with her collaborator Emmanuelle Charpentier, won the Nobel Prize in 2020. Her story is an “enthralling detective story” (Oprah Daily) that involves the most profound wonders of nature, from the origins of life to the future of our species.

 

a kind of bacterial/viral version of Capture The Flag.


DISCUSSION COMING SOON.





Wednesday, August 4, 2021

Can neurons be stimulated to regrow?

A SHARPER MIND: TAI CHI CAN IMPROVE COGNITIVE FUNCTION
Harvard Health Publishing article forwarded by Bill Steel


Research now shows that the brain has the ability to grow new cells, and make new connections throughout your entire healthspan. Various forms of exercise including Tai Chi can help improve executive function.








“In one study, researchers had nearly 400 Chinese men and women with some cognitive impairment perform either tai chi or a stretching and toning program three times a week. After a year, the tai chi group showed greater improvements, and only 2% of that group progressed to dementia, while 11% from the traditional exercise group did.”
 
This article is an analysis of 20 studies of Tai Chi and cognition.
 
Vince teaching Tai Chi on his 88th birthday.



Vince teaches Tai Chi on the beach.




2. On another line of research, there is a long history of using mushrooms as medicine in Japan, Korea, and China to enhance and protect innate defense mechanisms of the human body which are not found in western medicine.  For example: 


A globular, cascading icicle-forming mushroom when cooked tastes like lobster or shrimp.  Lion’s mane mushroom researcher Kara-Jiishi discovered in 1993 in Japan that this mushroom stimulates nerves to regrow.

More coming soon.  Stay tuned.


See also Dr. Juan R. Sanchez-Ramos. Department of Neurology, University of South Florida... Neurogenesis, the regrowing of neurons when treated with psilocybin.